EST details — SGN-E282931

Search information 
Request: 282931Match: SGN-E282931
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71228Clone name: cLER-17-E17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178857 is on microarray TOM1: SGN-S1-1-2.4.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178857 [TUS-30-D23] Trace: SGN-T184665 EST: SGN-E372225 Direction: 3' Facility: INRA
Clone: SGN-C178857 [TUS-30-D23] Trace: SGN-T184666 EST: SGN-E372226 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282931Length: 443 bp (621 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282931 [] (trimmed) TGCTTATGGATGTAGCAGTTGATTGAGTTTGCAGCTCGTCTGTTATTTGTTGTGGAGTCAGCATTATGGTTTGAGTTCTCATTCTTTCATCTTCC
CGTCGTCAGTGGCAGTAGCCTCTATTGCCACGGATATTTTGGCCAGAGAACGTCTCTTTTTTGTTTTTGTTTTTAGGGGGGTGGGAGTGTCCGAG
CATATGTGATGATGGCCGATTTGCTTCATTTAGGATTTTGATATGTTAATGTGCTAAAGCAAAATAGAAATGGTTAAACACCTATAATATTCGGG
ATTGAGCTGTTGTCATAGTCATTTTGCTAAGATTTTGTTTTTCAACTTCATTTTGAGAATTTGCTCCTTCTTTCAGTGCGTAATTAAACAGGACA
AGGAGACTCAATAGCAATTAGTATGTCAAGTTACCATTGAACCTTACCAGATGAAAGTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282931] SGN-U567344 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95782 [Download][View] Facility Assigned ID: TPRCM33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0057 Quality Trim Threshold: 12.5