EST details — SGN-E283112

Search information 
Request: 283112Match: SGN-E283112
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71336Clone name: cLER-17-I9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178894 is on microarray TOM1: SGN-S1-1-5.2.3.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178894 [TUS-30-F12] Trace: SGN-T1515 EST: SGN-E378181 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178894 [TUS-30-F12] Trace: SGN-T184931 EST: SGN-E372139 Direction: 3' Facility: INRA
Clone: SGN-C178894 [TUS-30-F12] Trace: SGN-T184932 EST: SGN-E372140 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283112Length: 513 bp (623 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283112 [] (trimmed) CTACACCACCCACATTCTACCTTCATCTCTCTCTACTTTCCGATTCACCTTCCTCCTCTTGATTTTGTTATTGTTCTATCGGCTATGTCAATAGA
CGGTGGAAGATTTTACTGGGAGAGGAATTCCAATGAAAAGGTCAAAGGAATTGTGATAATCTTCGCTTGGGTTTCAATTCAGGAAACTGAACTGA
AGAGCTATGTTGATCTTTATGCTTCTCTTGGTTGGAGCTCTCTTGTCTGCCTTGCCGATTTCGCTACCCTATACATAACTGAGAAGGCTACATCA
CTGGCATATTCTCTTCTGAGAGAGCTTGTCGAGGAGCTAAGATGTCGGCCTTGTCCAGTTGTTGTGGCAGCTCTTTCTGGTGGTTCTAAGGCCTG
CATGTATAAGTTTTTTCAGATTGTTAAAGGGAGATCTGAAGCTCAAGTTAATCTGGTACGCAATTCTTTGAATCTGCTGTGAGGAGGACAGCCAA
TTGGTCATTAACTGCATCTCAGGTCAAATTTATGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283112] SGN-U569771 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95963 [Download][View] Facility Assigned ID: TPRCM53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5