Notice: Load is currently high due to bots. Some functionality has been turned off.

EST details — SGN-E283183

Search information 
Request: 283183Match: SGN-E283183
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71299Clone name: cLER-17-H17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183487 is on microarray TOM1: SGN-S1-1-4.1.1.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T195946 EST: SGN-E394620 Direction: 5' Facility: INRA
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T195946 EST: SGN-E399144 Direction: 5' Facility: INRA
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T196118 EST: SGN-E394792 Direction: 3' Facility: INRA
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T200237 EST: SGN-E399143 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283183Length: 569 bp (797 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283183 [] (trimmed) AATTCCCATGAAATATGGGAGAATAGATGTTTCTGGACCTGATGAATGTCCAGAAGAGGGAAGGCTTCCTGATGCTGGCCCCCCTAACCCTTCAT
CTCATTTGCGAGATGTCTTCTACAGAATGGGACTAAATGATAAGGAAATTGTTGCACTTTCTGGGGCACACACTTTGGGGAGATCCAGACCAGAG
CGTAGTGGTTGGGGCAAGCCAGAAACAAGATACACGAAAGATGGACCAGGAAGCCCTGGAGGACAATCATGGACTGTGCAGTGGTTGAAATTTGA
CAATTCCTACTTTAAGGACATTAAAGAACAAAGAGATGAAGATCTACTAGTTTTGCCTACAGATGCTGTTCTTTTTGAAGATTCTTCATTTAAGG
AATATGCAGAGAAGTATGCTGTAAATCAAGATGTATTTTTCAAAGATTACGCGGAAGCCCATGCCAAACTGAGCAACCTTGGTGCTAAATTTGAT
CCACCTGAGGGTTTCTCAATAGACAATAATCCTACACAAGTTCAACCAGAGAAGTTCGTGGCAGCAAAATACTCAACTTGAAAGAGAGAGCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283183] SGN-U574727 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96034 [Download][View] Facility Assigned ID: TPRCO45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5