EST details — SGN-E283611

Search information 
Request: 283611Match: SGN-E283611
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77043Clone name: cLES-1-I15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186008 is on microarray TOM1: SGN-S1-1-3.2.7.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77043 [cLES-1-I15] Trace: SGN-T97286 EST: SGN-E283610 Direction: 5' Facility: TIGR
Clone: SGN-C186008 [TUS-48-N22] Trace: SGN-T192445 EST: SGN-E391119 Direction: 5' Facility: INRA
Clone: SGN-C186008 [TUS-48-N22] Trace: SGN-T192769 EST: SGN-E391443 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283611Length: 401 bp (818 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E283611 [] (trimmed) AAACAGCCAATCACAAAGCTTTTTATTGCAAACCATTACATAATTAGACAACAATCGGAAGGTATACCCAATTATCATTGGCCCCTTCCTTAACT
CAATCATAATTAAACAAACACAAATCCCAACTTAACAAAAAAATCAAACCAAACGGCAACAGAATCTCAAACCAGCCGTGTTAATCTTACATCCT
ATCAGACACAAGAGAAACGGCAGCACAATTTTCTTATAGAGCCAATACAAGACCCGGAACAGATTTACCGACCCGATTAGGTAAGCTACTCTCCC
AAACAGAGGGACAATGCAGAGGCGTAATAGAAGAAATATCGGATTGGTTTTTCTTCCGAAAACGGGTTACAGTAAGTGAGGTATTGAAATACTCC
CTAACCTGGGTAATTACCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283611] SGN-U581518 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97287 [Download][View] Facility Assigned ID: TPSAA56TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0220 Quality Trim Threshold: 14.5