Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E283687

Search information 
Request: 283687Match: SGN-E283687
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77115Clone name: cLES-1-P16
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190124 [TUS-59-J10] Trace: SGN-T340568 EST: SGN-E539693 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190124 [TUS-59-J10] Trace: SGN-T340571 EST: SGN-E539696 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283687Length: 423 bp (713 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283687 [] (trimmed) AATTTGCAAAGGGTAGTCTTACCAAAACTTCATTTAGAAACGGCGAGTTCTACCGCAAAACAGCGAACTAAATAATTGGTCAAGTTTAAGTTACA
TCTACAAACACCCAAATAAAGAAAGAAAAAAAAAGCGTAATATAACAAAAGTAACTAATGTCATTTCCAACCAAGGTTTACCCACTGATATCCCC
ATTTCAAGTACATTAGTACAAGGATTCCAAACTCTACTCAACTCTTCATGCTAATATTTGGCTAGAACGTCAAGTTTAGCTCCCGATGAAGCCCA
GCTTGTGAAGGATGACTGCTAAAAGTAGCACAAGTATAGCCAAGATCATGCCAGGTTTTCCTAAGAGCCAATTTTTTGTTTTCTTCGCACCTTCA
ACTCCTTTTTGAATTCTATCAGCCCACTTTATCATTTTTTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283687] SGN-U585222 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97363 [Download][View] Facility Assigned ID: TPSAD92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0183 Quality Trim Threshold: 14.5