EST details — SGN-E283966

Search information 
Request: 283966Match: SGN-E283966
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70225Clone name: cLER-13-P1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185369 is on microarray TOM1: SGN-S1-1-2.4.10.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185369 [TUS-47-D7] Trace: SGN-T192308 EST: SGN-E390982 Direction: 5' Facility: INRA
Clone: SGN-C185369 [TUS-47-D7] Trace: SGN-T197662 EST: SGN-E396336 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283966Length: 273 bp (698 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283966 [] (trimmed) TTTTTTTAAAAAGGATTTAATTCTTCAAAATAACAATTCAGAGAAGGGGATGAATTTTTCACACAACAAATTCATGACTTCGAATTATATAAATA
TATGATAAAAATATATTTTTTTTCGAATTACTCTTCTAGTTTTGATATTATTTTGTTTTTTGCGTTCGTTGTGCGTCTCTCCCCCTCTGAGACGA
CGAAAAGCATAATAACAGCAGCAGCAGTTATGGAGATCGGAATTCGATCTCTCTCTATTTTTTTTCATCATGAAATTTGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283966] SGN-U580201 Tomato 200607 Build 2 109 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94660 [Download][View] Facility Assigned ID: TPRBY85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5