EST details — SGN-E284811

Search information 
Request: 284811Match: SGN-E284811
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71787Clone name: cLER-19-C13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183524 is on microarray TOM1: SGN-S1-1-7.3.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T196024 EST: SGN-E394698 Direction: 5' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T196024 EST: SGN-E399261 Direction: 5' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T199655 EST: SGN-E398329 Direction: 3' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T200296 EST: SGN-E399260 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284811Length: 305 bp (966 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284811 [] (trimmed) CTGCATCAACTCAAATACACACTTTAAAAATTTATGGCTAAAGTTAAGATTGGAGTTAATGGATTCGGAAGAATTGGCCGATTGGTTGCTCGGGT
TGCTCTCCAAAGAAATGATGTTGAACTCGTCGCAGCGAACGATCCCTTCATTTTAGATGATTACGCTGACATATATGTTTAAGTATGATAGTGTA
CACGGCCAGTGGAAGCATCATGAGCTCAAGGTTAAAGATGAGAAGACTCTTCTCTTTGGTGAGAAGGCTGTTACTGTTTTTGGGTTTAGGAACCC
AGAGGAAATTCCATGGGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284811] SGN-U579788 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96383 [Download][View] Facility Assigned ID: TPRCU19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0234 Quality Trim Threshold: 14.5