EST details — SGN-E285492

Search information 
Request: 285492Match: SGN-E285492
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74527Clone name: cLES-10-C9
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190349 [TUS-60-C19] Trace: SGN-T340955 EST: SGN-E540080 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190349 [TUS-60-C19] Trace: SGN-T340957 EST: SGN-E540082 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285492Length: 370 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285492 [] (trimmed) GTGGGAAGCAATTTATCGATGAGCCATGCTTTTACTAGCTGCAAGTGCAATATTCCCTAATGCTGAGAGGAGAAGGCTAATTAATTTGATTCCGG
ACAGCGTGAGGAAAGCATGGAAAGATTGGGAAATAGAAGTGCTGATTCTAGGAAGCCTCATCTTACAGATTATGCTTATTCTTTTTGGCAAACGC
AGGCAGTGTGTGGCGAAGTTATGGATCAGAATGACTCTATGGGCATCTTACTTACTAGCAGATTGGATTGCTATTGCTTCATTAGGTATCATTGC
TCACAATACGTTGGATTAATGCAAACATACAAGTGATGATGACAATTTCAAGGATGAATTGATGACGATCTGGGCGCCATTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285492] SGN-U571937 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99632 [Download][View] Facility Assigned ID: TPSBK17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0314 Quality Trim Threshold: 14.5