EST details — SGN-E285796

Search information 
Request: 285796Match: SGN-E285796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78516Clone name: cLES-5-O16
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179001 is on microarray TOM1: SGN-S1-1-2.2.2.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179001 [TUS-30-J23] Trace: SGN-T184785 EST: SGN-E372345 Direction: 3' Facility: INRA
Clone: SGN-C179001 [TUS-30-J23] Trace: SGN-T184786 EST: SGN-E372346 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285796Length: 435 bp (752 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285796 [] (trimmed) TGAGGGCAGGGTCTCCAAGAGACTTGGAGAGCTTGTTCTTTTGGAGCAGCCTTTCATAAAAGATGATAGTGTTCTTGTGAAGGATTTGGTAAAGC
AAACTGTTGCTGCTCTTGGGGAGAACATAAAAGTTAGGAGGTTCGTTCGATTTACTCTAGGCGAGGAAGCCAAAAAAGAAGGAATAATTGAAGAG
CCAGCTGCTGTATGAAGCTAACTCTAACTTGAGATGAGCAAAGCATAGGAGGACACTCTACTTGTGGGATGAAACAAGTTATAAATCTTGGGGTT
GAGCTATTTTTGTATAATGTAGTCCATACTTGATGTACTGTGAGGCGATTAGNTTTCTTCTCTTTTACTTTCTTGTAGATTTTCTGGTCATGTGT
CTTGGATTTTCATCACAAACTAGGAGTTTCGGAAGCCATTTTAAAGCAAACATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285796] SGN-U567988 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98279 [Download][View] Facility Assigned ID: TPSAR92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0142 Quality Trim Threshold: 12.5