EST details — SGN-E285964

Search information 
Request: 285964Match: SGN-E285964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75229Clone name: cLES-13-F11
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184360 is on microarray TOM1: SGN-S1-1-3.2.16.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184360 [TUS-44-J6] Trace: SGN-T198406 EST: SGN-E397080 Direction: 3' Facility: INRA
Clone: SGN-C184360 [TUS-44-J6] Trace: SGN-T198407 EST: SGN-E397081 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285964Length: 254 bp (676 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285964 [] (trimmed) ATATTGGGTCTGCTCTCCTTGTTGCAAGATGAGAAATTGGGTAATGAGCAGCGGCTTCTTGTGGATTCAATGGTTAAAACCAGTAATGTCGTGTC
AACCCTAATAGATGATGTGATGGATACTTCAACAAAGGACAACGGTAGATTCCCTTTGGAGATGAGATATTTTCAGCTACATTCCATGATAAAAG
AAGCTGCTTGTCTTGCCAAGTGTTTGTGTGCTTATAGGGGTTATAATATTTCCATTGAGGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285964] SGN-U581695 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100277 [Download][View] Facility Assigned ID: TPSBY30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5