EST details — SGN-E286153

Search information 
Request: 286153Match: SGN-E286153
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75269Clone name: cLES-13-H12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185229 is on microarray TOM1: SGN-S1-1-6.2.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185229 [TUS-46-N11] Trace: SGN-T199058 EST: SGN-E397732 Direction: 5' Facility: INRA
Clone: SGN-C185229 [TUS-46-N11] Trace: SGN-T199112 EST: SGN-E397786 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286153Length: 298 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286153 [] (trimmed) CACTATTACAACATGATTTTGGAATACAAATGAAAAATATATATGCAGATGAAGAAAAATTACTAGAAGAGAATGGACTTAACTCAAGTGTAGTT
GCATTTGTAGAAAAGATCATTCTCTATTTAATTTTTTTTTTGTCCCTATTATATCTTATATTTTGTTTCCATTTTCTCATCATATAATTAAGTTA
AGTGTGGCATGATTGTGAAGTGTAGGAGAGCTTAAAAGGGCCAAAGTCTTATTCATTGCAACTTCTTTCTGTTCATGTTTTTGGCCCTCTTATCT
CCAAATTGAATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286153] SGN-U581270 Tomato 200607 Build 2 79 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100466 [Download][View] Facility Assigned ID: TPSBZ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0133 Quality Trim Threshold: 14.5