EST details — SGN-E286829

Search information 
Request: 286829Match: SGN-E286829
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75439Clone name: cLES-14-B19
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185233 is on microarray TOM1: SGN-S1-1-2.2.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185233 [TUS-46-N15] Trace: SGN-T199060 EST: SGN-E397734 Direction: 5' Facility: INRA
Clone: SGN-C185233 [TUS-46-N15] Trace: SGN-T199113 EST: SGN-E397787 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286829Length: 561 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286829 [] (trimmed) GCGGTACAATGAGTTCAGAAGGAATTTGCTGATGGTACCAATTAGCAAGTGGGAGGATTTAACTAACGACGAAGAAGTAATTGAGGCTTTACAAG
AAGTATATGGCGATGATATTGAGAAGCTAGATCTCCAAATTGGTTTGCACGCGGAGAAGAAAATTAAAGGCTTTGCCATTAGTGAGACTGCCTTT
TTTATATTTCTGCTCATTGCTTCAAGGAGGTTAGAGGCTGATCGATTCTTCACAACTGATTTCAATTCGCGAACCTACACAGAGAAAGGCTTTGA
ATGGGTAAACAAGACAGAGACATTGAAAGATGTCATCGATCGATACTTCCCTGAAATGACAGAGAAATACATGAGATGCACAAGTGCATTCTCAG
TGTGGAGTTCAGATCCAGATCCTAAACACTACTTACCTCTTTATCTGAGACCAGCAACCTAATGGTAGTACTATATTTGGTGATCAACTTTGTAT
GGGGTGATTATGTTAAAACAATGGTAAGTTTGCAAGGAAAATACAAACAACCCTAGTTTACGGTCAGATGAATAAACCTTGTATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286829] SGN-U569126 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100650 [Download][View] Facility Assigned ID: TPSCC10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0130 Quality Trim Threshold: 12.5