Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C28792

Search information 
Request: 28792Match: SGN-C28792
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28792Clone name: cLEF-49-D8
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176982 is on microarray TOM1: SGN-S1-1-5.2.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176982 [TUS-25-F20] Trace: SGN-T182127 EST: SGN-E369638 Direction: 3' Facility: INRA
Clone: SGN-C176982 [TUS-25-F20] Trace: SGN-T182128 EST: SGN-E369639 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248943Length: 510 bp (1045 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248943 [] (trimmed) AAGAAAACAAAACGCATCATGCTGCAATTCAGTACGATTGGTAATAATGTAGCAATTGCTAGTTAGGGCTACAAAAGTCTTTACAAATCAATAAC
AACATTATATACAAATTGTATATGAAAGCTTTTTTTTTATCATACTTGCTGAAGTTGTATAACCAAAATTGTTACCCCTACCCTTCTATCCCCTC
CAGAGGAAACACTAACAAGTGAAGGCATATAGAAAGGTACAAGCGTGGTAGAAAAGATCATGACCAAACATGTCCTCCATCCGACTTCTTTTGTT
TCTTCTTTCTCTTCTTCTCTTGTTTCGTATCTTCCCTTTCTTCAGTACGTTTATCATTGTGTGCGCGTATCTCCAATAATTTAGTCTTTTTATCT
CGAAATACAGCATCCGAACGTGAAGACATAAATTGCGTGGAATGATCCATTCCAGCAAGGTTGAAACCCATAATATCTTTGCGTTCTTTGACTTT
TGCAGCAAGACTGTCGCTTAAACGGGTAATGAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248943] SGN-U563134 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62451 [Download][View] Facility Assigned ID: TMGHN16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5