EST details — SGN-C28817

Search information 
Request: 28817Match: SGN-C28817
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28817Clone name: cLEF-49-F11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176995 is on microarray TOM1: SGN-S1-1-8.3.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176995 [TUS-25-G9] Trace: SGN-T181666 EST: SGN-E369804 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248907Length: 132 bp (944 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248907 [] (trimmed) CTCATGATGATTTTGAAAACAAACATGGAGCTATCACCTCCATGGATGAAAATGCTGATGGATTCAGAGATCTTGTTAGGCACACAATGTTTGAG
AAAGGACAAAGTAAACGAATTTGGAGTGAGCTCTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248907] SGN-U562701 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62415 [Download][View] Facility Assigned ID: TMGHM30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0495 Quality Trim Threshold: 14.5