EST details — SGN-E288261

Search information 
Request: 288261Match: SGN-E288261
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76106Clone name: cLES-16-O17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184416 is on microarray TOM1: SGN-S1-1-3.4.16.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184416 [TUS-44-L14] Trace: SGN-T198427 EST: SGN-E397101 Direction: 3' Facility: INRA
Clone: SGN-C184416 [TUS-44-L14] Trace: SGN-T198428 EST: SGN-E397102 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288261Length: 506 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288261 [] (trimmed) CAGAAGAAAGGCAATATTTTGATGCAAAGGTATGAGATTGGGAAATTGCTTGGGCAGGGTACATTTGCAAAAGTATACCATGCTAGAAATCTCAA
AACAGGGCAAAGTGTTGCTATTAAGGTGATTGACAAAGAGAAGATTATGAAGGTTGGGTTAATTGATCAAACGAAACGTGAAATCTCCGTCATGA
GGCTAATCAAACACCCAAATATTGTCCAGCTCTATGAGGTTATGGCGAGCAAAACAAAAATATATTTTGCTATGGAATATGTTAGAAGTGGTGAA
CTTTTCAATAAGGTTGCTAAAGGCAGACTTAAAGAAGATGCTGCAAGAAAATACTTTCAACAGTTAATCGCTGCAGTCGATTTCTGTCATAGGCG
TGATGTCTACCACCGTGATCTCAAGCCTGAAAATCTCCTGCTTGACGAAGGTGGCAATCTGAAAGTCTCGGATTTTGGTCTGAGTGCATTGTTTG
ATTCGAAAAGGCAAGATGGTCTACTCCACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288261] SGN-U584790 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100987 [Download][View] Facility Assigned ID: TPSCI93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5