EST details — SGN-E289155
| Search information |
| Request: 289155 | Match: SGN-E289155 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C76687 | Clone name: cLES-18-N1 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C179208 is on microarray TOM1: SGN-S1-1-3.3.2.11
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C179208 [TUS-31-C14] | Trace: SGN-T185187 | EST: SGN-E373745 | Direction: 3' | Facility: INRA |
| Clone: SGN-C179208 [TUS-31-C14] | Trace: SGN-T185188 | EST: SGN-E373746 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E289155 | Length: 157 bp (900 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E289155 [] (trimmed)
CTTGAAGCACGACACCACGTGTTCATCAATTTACGAACAGAGAAAGTGTATTGTCTTCCTGATGGATATGAAGTCATAGATCCATCGCTGGATGA
CATTATTCATGTGCTGAATCCAAGATTTGATCATGAACAGGGTTAGCGACTCGATAAGAACC
CATTATTCATGTGCTGAATCCAAGATTTGATCATGAACAGGGTTAGCGACTCGATAAGAACC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E289155] | SGN-U587386 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T101597 [Download][View] | Facility Assigned ID: TPSCS73TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.969 | Expected Error Rate: 0.0406 | Quality Trim Threshold: 12.5 |
Working
