EST details — SGN-E289239

Search information 
Request: 289239Match: SGN-E289239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76720Clone name: cLES-18-O21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179218 is on microarray TOM1: SGN-S1-1-1.3.2.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179218 [TUS-31-C24] Trace: SGN-T185191 EST: SGN-E373749 Direction: 3' Facility: INRA
Clone: SGN-C179218 [TUS-31-C24] Trace: SGN-T185192 EST: SGN-E373750 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289239Length: 282 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289239 [] (trimmed) TTAGATTCAAAGACGGCGGTTCTTTTAGCAATCTGTGTTTTGATACAGTAGAAACAAAACATAGTATGTAGTCACTAGCTAGCATCATCTGAGCG
AATCTAGGCCAAACAAGAAACACCAAGGTGATGTGCTCTGCTAGGTATCTTCTAAACTTACTATACTGGGAGACGGAGAGAGACGGAGAGACGGT
TCCTCTACCAGTGCCAAATGAGTTGTAAACAGGAGGGGGGAAGCTCTAACTCATTGACATTAGCTTTGGACCATTATGTGGAATGCCCATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289239] SGN-U573209 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101681 [Download][View] Facility Assigned ID: TPSCQ95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0271 Quality Trim Threshold: 14.5