EST details — SGN-E289993

Search information 
Request: 289993Match: SGN-E289993
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88872Clone name: cLET-9-P12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182023 is on microarray TOM1: SGN-S1-1-4.4.10.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182023 [TUS-38-H21] Trace: SGN-T194461 EST: SGN-E393135 Direction: 5' Facility: INRA
Clone: SGN-C182023 [TUS-38-H21] Trace: SGN-T194708 EST: SGN-E393382 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289993Length: 392 bp (727 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289993 [] (trimmed) TCTTTTTTTCCAACAATTTTTCTCTCTCACACACCATTTCTTTAATCAAATTTTCTGATGAATTTTCTTGTGATTGAAACTATGAATTTGTGATC
GAATTAAAAGCTGTGATTGTTAGAGTTCTGCTGAGGATTAAGTGCTTTTTTTCTCTACAAAACTTTGTAATTCAGGCAAAATGAGCTCTTTGCAA
GGGCCTGTTGTTTGTCCTCTGGTTCATGTAAAGCAAACAGGTAGACTCACTTCACCTATAGTAAAGGCTAAGATGCTGAGGAGTACTGAGTTTTG
GGGATTTAATGGGATACATAGACGGCGGATTAATGTGGTTCGTCTACCACGATCACGTATAAGCAAGTTGATCGTATGTAGTTTCAATTCATCAT
CAAATGACAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289993] SGN-U578509 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104808 [Download][View] Facility Assigned ID: TMEBJ90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5