Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E290166

Search information 
Request: 290166Match: SGN-E290166
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87600Clone name: cLET-5-E13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183523 is on microarray TOM1: SGN-S1-1-8.3.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183523 [TUS-42-G9] Trace: SGN-T195485 EST: SGN-E394159 Direction: 3' Facility: INRA
Clone: SGN-C183523 [TUS-42-G9] Trace: SGN-T195950 EST: SGN-E399151 Direction: 3' Facility: INRA
Clone: SGN-C183523 [TUS-42-G9] Trace: SGN-T200449 EST: SGN-E399557 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290166Length: 479 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290166 [] (trimmed) GGTTTTTTCTTTGTAATATAATTTTCATTCTCAAACGAAATCCAATATGCAGCGAAGTGCTGAACGAATCGCCACCATCTCAGCCCATCTTAACC
CTTCTCCTTCTTCTCACCAGATGGAGGGATTGAGTGCAGCTAATTGCAGGGCGAAAGGGGGTTCTCCGGGGTTCAAAGTTGCGATCTTGGGTGCT
GCAGGAGGTATTGGTCAGCCACTTGCAATGCTTATGAAGATGAATCCTTTGGTTTCGGTTCTGCATCTTTATGATGTTGCAAATACCCCTGGTGT
AACTGCTGATATTAGCCACATGGATACTGGTGCTGTGGTTCGTGGTTTTCTAGGACCTCAACAATTAGAAGATGCTCTCACTGGCATGGACCTCG
TAATAATCCCTGCTGGTGTTCCTAGAAAACCAGGCATGACAAGAGATGATCTTTTCAACATAAATGCAGGAATCGTGAAGACTTTATGTGAAGGA
ATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290166] SGN-U574918 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103614 [Download][View] Facility Assigned ID: TMEAQ31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5