EST details — SGN-C29046
| Search information |
| Request: 29046 | Match: SGN-C29046 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C29046 | Clone name: cLEF-49-P9 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: Alias clone SGN-C177130 is on microarray TOM1: SGN-S1-1-1.4.8.11
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C177130 [TUS-25-L24] | Trace: SGN-T182078 | EST: SGN-E369589 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E249106 | Length: 161 bp (980 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E249106 [] (trimmed)
ATGAACAAGCCACTGAGAATTCTCGTGAAGCGTGATGAGCTCACTCTTGAAGGTATTAAACAATTCTATGTCAACGTCGATAAGGAAGAGTGGAA
ACTTGAAACACTTTGTGATCTTTACAAAACCTTGGCCATCACCCATAGTGTCATCTTTGTCAACAC
ACTTGAAACACTTTGTGATCTTTACAAAACCTTGGCCATCACCCATAGTGTCATCTTTGTCAACAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E249106] | SGN-U578071 | Tomato 200607 | Build 2 | 63 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T62614 [Download][View] | Facility Assigned ID: TMGHM89TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.948 | Expected Error Rate: 0.0450 | Quality Trim Threshold: 14.5 |
Working
