EST details — SGN-E290524

Search information 
Request: 290524Match: SGN-E290524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77158Clone name: cLES-20-C12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184611 is on microarray TOM1: SGN-S1-1-8.4.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184611 [TUS-45-D17] Trace: SGN-T1839 EST: SGN-E378636 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184611 [TUS-45-D17] Trace: SGN-T198664 EST: SGN-E397338 Direction: 3' Facility: INRA
Clone: SGN-C184611 [TUS-45-D17] Trace: SGN-T198665 EST: SGN-E397339 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290524Length: 278 bp (531 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290524 [] (trimmed) GGAAAGTGGAAGGCTCCTATGATTGACAACCCAGACTTCAAGGATGACCCAGATCTATATGTTTTCCCAAAATTGAAGTATGTTGGAGTGGAGCT
GTGGCAAGTGAAATCTGGAACTTTGTTTGACAATGTTGTGATATGCGATGATCCAGAGTTTGCCAAGTCAATTGCAGAGGAAACATGGGGAAAGC
AGAAAGATGCTGAAAAGGCTGCTTTTGAGGAAGCAGAAAAGAAGAGAGAGGAGGAGGAATCAAAGAATGCTCCAGCTGAATCTGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290524] SGN-U578018 Tomato 200607 Build 2 149 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102203 [Download][View] Facility Assigned ID: TPSCZ18THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5