EST details — SGN-E290577

Search information 
Request: 290577Match: SGN-E290577
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77285Clone name: cLES-20-H5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179298 is on microarray TOM1: SGN-S1-1-1.3.2.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179298 [TUS-31-G8] Trace: SGN-T185295 EST: SGN-E373853 Direction: 3' Facility: INRA
Clone: SGN-C179298 [TUS-31-G8] Trace: SGN-T185296 EST: SGN-E373854 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290577Length: 317 bp (1103 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290577 [] (trimmed) GATTTTGAAAACTCAAGATGTTTATTTATTGTCCGCAAGGATGGTGAAACAGTGGACTTTTCATACTGGAAATGCATAAAGGGGTTAATTAGAAA
AAACTATCCACTCTATGCTGACAGTTTTATCCTCAGGCATTTTCGGAAGCGGAGGCGTAATGACTGAATGTATCATTCGGAAACTCGTAGCTACC
CTGAATTTCATGCAAAGGAGATTCTTTTACTATTGCCGAGCACATTATGTTGAGTGTCGATCAAATATTTTTGAAGGTTGTGATATAAGTTCATA
TTTATTGGGAGATTACTGCAATCTACTCACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290577] SGN-U570991 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102256 [Download][View] Facility Assigned ID: TPSDA39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0035 Quality Trim Threshold: 12.5