Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E291796

Search information 
Request: 291796Match: SGN-E291796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88243Clone name: cLET-7-I23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190742 [TUS-61-D4] Trace: SGN-T349312 EST: SGN-E548437 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291796Length: 402 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291796 [] (trimmed) TACCTGCAGGTTTAGCTGCTCTAATGTTGTTTCTCACAGATTTACAAGAAGAATTAACATGGGGTTTCGTTCTTTTCAAGAAATTTCTACAAGGA
ATAGTGTTGTTAACTTAAGAAAAGCTCATTTTTGGGAAGATCCTGATGATGGTAGTGATAGTGAAGAAGAAGAAGAAGAAGAAGAGGAGAGGGAA
GAAGATATGGATGTTGAGAGTAGCTTTGAATATGAAGAAAATAGAGCTATGGACAATTCTACAAATGGTTTGTCTAACAGGGAAGATGAGTTTGT
GAAAGAAGTTGAACAGCTTTTGAGTCCAGAGGAAAGGGAAATTTTGTATCACAATCAAACTCCAAAGCTGGATAAGATATCAACTGAAAAATGGA
ACCCTCTTCACACTTTTGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291796] SGN-U568290 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104049 [Download][View] Facility Assigned ID: TMEAY60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5