EST details — SGN-E292067

Search information 
Request: 292067Match: SGN-E292067
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82187Clone name: cLET-1-C9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179406 is on microarray TOM1: SGN-S1-1-5.3.2.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82187 [cLET-1-C9] Trace: SGN-T102340 EST: SGN-E292066 Direction: 5' Facility: TIGR
Clone: SGN-C179406 [TUS-31-K20] Trace: SGN-T185234 EST: SGN-E373792 Direction: 3' Facility: INRA
Clone: SGN-C179406 [TUS-31-K20] Trace: SGN-T185235 EST: SGN-E373793 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292067Length: 459 bp (554 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292067 [] (trimmed) GAAATGAAGTTTCTCTTATACCAAATAAATCTTTCACAAGTGTTCTGTAGAGGTTTCAACAGGCTTACATATTTCAAGGGAAGTGCAATTGATAT
ACCCATAAATTACTCATATTTAATGATGAATAATGAGTTTGTTTCTGCAATATTGGCAGAAAAATAATATGATTGTAAATTGTTGCTTATTTAGA
CACCATGTTGTGACATGTTTTATCACATGGATAAGCACAGTCAATCGCCTTCATTCCTTCTCTATCAAAATACCAATCTCCAACTGCAAGTGCAA
TCGTCTTGTTATCGATAAGGGGAGAATCGTCAGCAAACCATGTATCCTGCCTCTCGGATTGGCAATGAGCGAAGCAAGAGTTTATGAACAACCCA
CTTTGTGTTGAGGCACCGAAGCCTTTAATAGCATTTAGCATATCATTTCTGAAATCTTGTAGAAATTGAATTTGTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292067] SGN-U580803 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102341 [Download][View] Facility Assigned ID: TMEAA17TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0006 Quality Trim Threshold: 14.5