EST details — SGN-E292138

Search information 
Request: 292138Match: SGN-E292138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82393Clone name: cLET-1-M23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179551 is on microarray TOM1: SGN-S1-1-4.1.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82393 [cLET-1-M23] Trace: SGN-T102592 EST: SGN-E292318 Direction: 5' Facility: TIGR
Clone: SGN-C179551 [TUS-32-A21] Trace: SGN-T185800 EST: SGN-E373137 Direction: 3' Facility: INRA
Clone: SGN-C179551 [TUS-32-A21] Trace: SGN-T185801 EST: SGN-E373138 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292138Length: 452 bp (607 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292138 [] (trimmed) GGAGATTAAGCAACAAAATCGAGATTAGCATTAGCAAGTCTATGAGTATCTTATTTAATTGTAGTCTTAAGATTAAACATAAACTGGTAGAAGCA
ACACAACAACCAATTACGGTTAACCCTAGAACTCGACCCGACACGACCCGACCAAAGCAGTAGAGATAGTTTGAAATTAAAAACAAAGCCTAAAA
CGGCGACTCAAATACATAAAAGACTGATAAAACTAGATCATCATCATCATCAGATCTAGAGTTGACCGCAGTCAGCAATAACCACAGGCTTGGAG
CACCTTCCAGAGCTAGATCCAACAGCCTCTGCCTTCTTAATCACATCCATGCCTTCAACAACTTGTCCAAACACGACGTGCTTTCCGTTGAGCCA
CTCAGTCTTAGCGGTACAGATGAAAAACTGAGAACCGTTGGTTCCAGGTCCAGCATTAGCCATGGAGAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292138] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102412 [Download][View] Facility Assigned ID: TMEAA84TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5