EST details — SGN-E292274

Search information 
Request: 292274Match: SGN-E292274
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82140Clone name: cLET-1-A23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183537 is on microarray TOM1: SGN-S1-1-2.3.1.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82140 [cLET-1-A23] Trace: SGN-T102333 EST: SGN-E292059 Direction: 3' Facility: TIGR
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T194938 EST: SGN-E393612 Direction: 5' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T195955 EST: SGN-E394629 Direction: 5' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T195955 EST: SGN-E399160 Direction: 5' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199570 EST: SGN-E398244 Direction: 3' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199670 EST: SGN-E398344 Direction: 3' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199670 EST: SGN-E399159 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292274Length: 587 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292274 [] (trimmed) TTCTAATTATTTTTCTCTATTCATTCATATTTTCATATATACTAAAAATATTTTTCCTTTACATAACTCAACAGCCAATTTTCCATTTTGATGTC
ACAAATTCTTTGAACTTTTTCAGTTCTTCTAAAACATAGGGGACTTTTTAAGGACTTGAAGAAGAAAGATGAGTTCAACCATGAAGGGGTTGTTG
CTAAAGCCCAATACAAATAATATGTACATGACAAAATTACTAAAACACAAGTATGCAGAAGAGCAATTTCTAGCAAAGTACTCTTCTTTTGGCAT
TCATATGAATTGCTCAAAATGGAGTAGTAAAGTCATTAGATGTCATCAACAAGAACCTAATGGCTTTTCAAATTCCCCAGTAACTCCAATAAGAG
AGCAAACCCCTCCACCTCAGGCAATTTTGAGTCCTGTTTCAGAAACTACATCAACTGCAAAAAAGAGAGTTTATACTTTTGGAAAAGGAAGAAGT
GAAGGAAACAAGGGCATGAAGTCCTTGTTGGGAGGTAAAGGAGCAAACCTTGCTGAAATGGCAAGCATTGGATTGTCCGTGCCGCCGGGGCTTAC
TATATCAACAGAAGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292274] SGN-U578309 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102548 [Download][View] Facility Assigned ID: TMEAA12THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5