EST details — SGN-E292363

Search information 
Request: 292363Match: SGN-E292363
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82396Clone name: cLET-1-M4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179553 is on microarray TOM1: SGN-S1-1-2.1.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179553 [TUS-32-A23] Trace: SGN-T185713 EST: SGN-E373050 Direction: 3' Facility: INRA
Clone: SGN-C179553 [TUS-32-A23] Trace: SGN-T185714 EST: SGN-E373051 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292363Length: 285 bp (944 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292363 [] (trimmed) GAAATACTTCAGTCTAGAGGTACATTCACTTAGAGCTAATTCAGTACCTGCTATAGAAAGAACTTCTCCCAATCGACGTTTACAAAAGAAAGGGA
CTTCTCGTGTAAGGTTTGAACGTAGATTGTTTAGTATAGAACTTTTCATTTTCTTTGCCTTTTTTTCCTTGTCCCTTGCATATGGTTGAGATGTA
AAATTGGATAGCGGAATATACTTACGAGATAATTGTTCCATTACATTATCTGATGAAAAACAATGCAACGTAAAAGCAGATTGTTCGTCCCTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292363] SGN-U572252 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102637 [Download][View] Facility Assigned ID: TMEAB74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5