EST details — SGN-E292554

Search information 
Request: 292554Match: SGN-E292554
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81431Clone name: cLET-16-G22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184829 is on microarray TOM1: SGN-S1-1-6.1.14.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184829 [TUS-45-M19] Trace: SGN-T1847 EST: SGN-E378231 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184829 [TUS-45-M19] Trace: SGN-T198513 EST: SGN-E397187 Direction: 5' Facility: INRA
Clone: SGN-C184829 [TUS-45-M19] Trace: SGN-T200026 EST: SGN-E398700 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292554Length: 469 bp (942 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292554 [] (trimmed) AGGCATTTTGTACTATAAACTATTTCTCTTTCATTCCTTTCTCACTTTTCTTTGCTTTTGGGTTTCTGGTTTATTTTTTCTCTTCTAGTTTTGCT
TTGGTTTGATCTGCTTCGTGGGGGTCTTTATATTCTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAGGGACTTTA
TGGGATTGAATATCAAAGATTCTTTACTTGTAGTCAAGGATGAACCTGTTGAAAGCTCAAAAGACTCTGGGTTTCGCTGGCCAATGTCGAGCAAG
GTTGGTGTACCTCATTTCATGTCCTTGAACTCTGCTCAAGATGAGAACACCTTCAAAGCTCTATCTGCCACAGATGGAGTCGATGCTGGTCTCAA
ACGTCAGCCTGGTGAACTCCAGATGAAGCAAGTTCTTGGTGGAATTCCTGTTACAGCTCCTCATTCAATGCTTCCATCGCGTGGCTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292554] SGN-U564446 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106687 [Download][View] Facility Assigned ID: TMECJ47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5