EST details — SGN-E292632

Search information 
Request: 292632Match: SGN-E292632
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80193Clone name: cLET-11-I15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184765 is on microarray TOM1: SGN-S1-1-6.3.14.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184765 [TUS-45-K3] Trace: SGN-T198498 EST: SGN-E397172 Direction: 5' Facility: INRA
Clone: SGN-C184765 [TUS-45-K3] Trace: SGN-T198578 EST: SGN-E397252 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292632Length: 429 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292632 [] (trimmed) CCTGATGGTAAAGATGAGTATGATCGGTGGGGAAACGTGAAATGTCATGGTAAAGAAAGTGATATTAAGGAAGGACATAAGAGTTTCCCAAGCGG
ACATACAAGTGCATCATTTGCTGGTCTCGGGTTTCTATCATTGTATTTGGCTGGGAAGATTAAAGCATTTGATCGACGAGGGCATATAGCTAAAC
TATGCATAGTTTTTCTTCCTCTTCTAATGGCATCTCTTGTCGGGGTCTCACGTGTGGATGACTACTGGCATCATTGGCAAGACGTATTTGCTGGA
GGACTGATAGGTCTTTTCGTTGCAGCGTTCTGTTATCTGCAGTTCTTCCCAGCTCCATACCATACTGAAGGATGGGGACCATATGCATATTTCCG
GGCAGTGGAGGAGGTTCGTGTTAGCAGACAACACGCCACCCCTACCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292632] SGN-U571861 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105095 [Download][View] Facility Assigned ID: TMEBO56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5