EST details — SGN-E292700

Search information 
Request: 292700Match: SGN-E292700
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80047Clone name: cLET-11-B21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179613 is on microarray TOM1: SGN-S1-1-6.4.1.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179613 [TUS-32-D11] Trace: SGN-T186045 EST: SGN-E372892 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292700Length: 347 bp (835 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292700 [] (trimmed) TACTTGAACATCAAGAGCTTGCTTGATCTCACTTGCCAGACCGTGGCAGACATGATTAAAGGGAAAACACCAGAGGAGATCCGGAAGACCTTTAA
CATCAAGAATGACTTCACTCCTGAGGAAGAAGAGGAGGTTAGGAGGGAGAATGCTTGGGCATTTGAGTGAATCTGCATTGGAGGATAAATTTGGA
TTATATTTTCTATAAGATCGTCTGAACAATCTTGTGTGAGTAAATATTTAGTATGCTATTTCTGCTTTTCACTGTTGGCTTTGTCCTAACTAAGT
GACTTGAACCTCCTTTTGCTATTGTTATGTCTGGGTTTAATGTTATGAAGTCTTAAGTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292700] SGN-U580638 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105163 [Download][View] Facility Assigned ID: TMEBQ11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0031 Quality Trim Threshold: 12.5