EST details — SGN-E292773

Search information 
Request: 292773Match: SGN-E292773
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80259Clone name: cLET-11-L16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184982 is on microarray TOM1: SGN-S1-1-5.4.12.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184982 [TUS-46-D4] Trace: SGN-T192246 EST: SGN-E390920 Direction: 3' Facility: INRA
Clone: SGN-C184982 [TUS-46-D4] Trace: SGN-T197611 EST: SGN-E396285 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292773Length: 501 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292773 [] (trimmed) AATTATTTCTGGTTTTTTTCTTGTTGTTGTTGAAAATAGACACGCAAAAGCAACCACTGTGGCATTATGGTTCAGGAGAAATATTATATGTCAAT
TAGAATAATATTGTGCACAGTCTCATACAAGCCACTGAAGGATGAAATATCCAAATCATCATGGCGTAAACTATTTGGATGAGGATGATGGCAAG
CACAGTAATGAGCTCATTGAGCCTAAAGCCAACTTTCACTCTGGAGAAAATATCAGTGAAAGGGCTTCCATCACTTACTAGATCTTCTTCTTCCT
TCAAAGTTGTGGCTAGTGGTGTTAAGAAGCTTAAGACTGACAAACCCTATGGAATTAATGGAAGCATGGCCTTGAGAGATGGGGTTGATGCCTCA
GGCAGGAAGCCCAAGGGAAAGGGTGTGTACCAATATGTTGACAAATATGGAGCTAATGTTGATGGATACAGTCCCATCTACAACACGGATGAATG
GTCTCCAAGTGGTGATGTCTATGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292773] SGN-U581090 Tomato 200607 Build 2 465 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105236 [Download][View] Facility Assigned ID: TMEBR68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5