EST details — SGN-E292828
| Search information |
| Request: 292828 | Match: SGN-E292828 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C80334 | Clone name: cLET-11-O21 |
| ||
| Library Name: cLET | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4-6 weeks
Microarray: Alias clone SGN-C179737 is on microarray TOM1: SGN-S1-1-2.1.1.16
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C179737 [TUS-32-I15] | Trace: SGN-T185838 | EST: SGN-E373175 | Direction: 3' | Facility: INRA |
| Clone: SGN-C179737 [TUS-32-I15] | Trace: SGN-T185839 | EST: SGN-E373176 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E292828 | Length: 240 bp (876 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E292828 [] (trimmed)
CTCGCTTTTCTTACTCCGTGCTGCTGGTTTTCTTCTACCTTGCTACATCATGGCTTGGGCTATAAGTATCATGCAGCGTCCAAGGCAAAGACAGG
AGGCTGCAGCACTAGCGGCAGCAGAGGTTGCTTTCATGCTGCAAGCAGGGCAACATAGGGGCTTGCATGTAACAATAGCACCAGGACCTGCACAG
GCAGCAGAACCTTCAGCAGCACCAGCAAACCCAACTACCCATGTTGCAAC
AGGCTGCAGCACTAGCGGCAGCAGAGGTTGCTTTCATGCTGCAAGCAGGGCAACATAGGGGCTTGCATGTAACAATAGCACCAGGACCTGCACAG
GCAGCAGAACCTTCAGCAGCACCAGCAAACCCAACTACCCATGTTGCAAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E292828] | SGN-U576622 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T105291 [Download][View] | Facility Assigned ID: TMEBO95TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.960 | Expected Error Rate: 0.0329 | Quality Trim Threshold: 12.5 |


