EST details — SGN-E292828

Search information 
Request: 292828Match: SGN-E292828
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80334Clone name: cLET-11-O21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179737 is on microarray TOM1: SGN-S1-1-2.1.1.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179737 [TUS-32-I15] Trace: SGN-T185838 EST: SGN-E373175 Direction: 3' Facility: INRA
Clone: SGN-C179737 [TUS-32-I15] Trace: SGN-T185839 EST: SGN-E373176 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292828Length: 240 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292828 [] (trimmed) CTCGCTTTTCTTACTCCGTGCTGCTGGTTTTCTTCTACCTTGCTACATCATGGCTTGGGCTATAAGTATCATGCAGCGTCCAAGGCAAAGACAGG
AGGCTGCAGCACTAGCGGCAGCAGAGGTTGCTTTCATGCTGCAAGCAGGGCAACATAGGGGCTTGCATGTAACAATAGCACCAGGACCTGCACAG
GCAGCAGAACCTTCAGCAGCACCAGCAAACCCAACTACCCATGTTGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292828] SGN-U576622 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105291 [Download][View] Facility Assigned ID: TMEBO95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0329 Quality Trim Threshold: 12.5