EST details — SGN-E292837

Search information 
Request: 292837Match: SGN-E292837
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80063Clone name: cLET-11-C18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179617 is on microarray TOM1: SGN-S1-1-2.4.1.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179617 [TUS-32-D15] Trace: SGN-T186046 EST: SGN-E372893 Direction: 3' Facility: INRA
Clone: SGN-C179617 [TUS-32-D15] Trace: SGN-T186047 EST: SGN-E372894 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292837Length: 282 bp (770 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292837 [] (trimmed) TTGATGGTCGCAACATCACCGTGAACGAAGCTCAATCACGCGGAGGCGGAGGAAGTGTAGGTTACTGCACATTTTTAAGTACATGTCAGCACAAA
AAAAAAATTGCCAAATAAAATGTATGTCACTTGCTTACGCAAGACCCCTCTGTTTGAACACATCAAGCATCGTGACACCAATTTTAGCAAGAGAC
TCGCATACTGTAACCCCAGCTTCCTTGAGAGCTTTGATCTTGTCCTGTGCTGTCCCCTTTCCACCAGATACAATGGCCCCAGCATGACCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292837] SGN-U590907 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105300 [Download][View] Facility Assigned ID: TMEBP21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0373 Quality Trim Threshold: 14.5