EST details — SGN-E293018
| Search information |
| Request: 293018 | Match: SGN-E293018 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C80470 | Clone name: cLET-12-F22 |
| ||
| Library Name: cLET | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4-6 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E293018 | Length: 172 bp (819 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E293018 [] (trimmed)
ACGCCCTATACTGTATATTTTGAAAAAGCCAGGCAAACTCTTGGTACTGGAAAGATGATGAACCCCAATGATCCCGAAGAGAATCCAGATATGTT
TCGTAATCTTGCTCCACCACCTGAAGTTGCTCCTCAATCCAAGCCTTAAAGACAAACAGAGGAACCACCAATTGGGC
TCGTAATCTTGCTCCACCACCTGAAGTTGCTCCTCAATCCAAGCCTTAAAGACAAACAGAGGAACCACCAATTGGGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E293018] | SGN-U579628 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T105481 [Download][View] | Facility Assigned ID: TMEBV35TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.906 | Expected Error Rate: 0.0176 | Quality Trim Threshold: 20.5 |
Working
