EST details — SGN-E293687

Search information 
Request: 293687Match: SGN-E293687
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82725Clone name: cLET-21-B4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190974 [TUS-61-M20] Trace: SGN-T342028 EST: SGN-E541153 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190974 [TUS-61-M20] Trace: SGN-T342031 EST: SGN-E541156 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293687Length: 269 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293687 [] (trimmed) TTTGCTCCAAGTCTTTGCCAACTTCGTTGGAGAATGAAAGAAATGCAGCCGAATTGATCTTGGATAAACCACATTACCTTCATTGTTGCCTCAAA
CTGAAATTCTTTTGTTGTGATTTCTCAAAGCTGTGAACTTTTACTTTCTCCCATTTAGTCCTTTCAAGGATGGGGAGAAAGTACATTAGTTTTAT
ATAGGCTCCTTGAAGTAGTACAAGTATCATCACTTTAGGAAAATGACTTTTAAGTTTTCATAAATGATATTTCATATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293687] SGN-U569940 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107809 [Download][View] Facility Assigned ID: TMEDF02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5