EST details — SGN-E293733

Search information 
Request: 293733Match: SGN-E293733
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82850Clone name: cLET-21-P4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184588 is on microarray TOM1: SGN-S1-1-7.3.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184588 [TUS-45-C18] Trace: SGN-T198608 EST: SGN-E397282 Direction: 3' Facility: INRA
Clone: SGN-C184588 [TUS-45-C18] Trace: SGN-T199739 EST: SGN-E398413 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293733Length: 477 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293733 [] (trimmed) GTTTTGTTTTGGTTTGATCTGCTTCGTGGGGTTCTTTATATTCTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAG
GGACTTTATGGGATTGAATATCAAAGATTCTTTACTTGTAGTCAAGGATGAACCTGTTGAAAGCTCAAAAGACTCTGGGTTTCGCTGGCCAATGT
CGAGCAAGGTTGGTGTACCTCATTTCATGTCCTTGAACTCTGCTCAAGATGAGAACACCTTCAAAGCTCTATCTGCCACAGATGGAGTCGATGCT
GGTCTCAAACGTCAGCCTGGTGAACTCCAGAATGTGCATGCAATGCATCTTCCATATGATGTTAAGATGCTTCCATTTAACATGAACAACCCCTC
CTACAAGACTCATTTTGGTGGTATTGGCCAGATGAAGCAAGTTCTTGGTGGAATTCCTGTTACAGCTCCTCATTCAATGCTTNCATCGCGTGGCT
CT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293733] SGN-U564449 Tomato 200607 Build 2 121 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107855 [Download][View] Facility Assigned ID: TMEDF86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5