Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E294168

Search information 
Request: 294168Match: SGN-E294168
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80777Clone name: cLET-13-F8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179778 is on microarray TOM1: SGN-S1-1-1.3.1.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179778 [TUS-32-K8] Trace: SGN-T186004 EST: SGN-E372509 Direction: 3' Facility: INRA
Clone: SGN-C179778 [TUS-32-K8] Trace: SGN-T186005 EST: SGN-E372510 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294168Length: 568 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294168 [] (trimmed) GAAAGCTGGTATGCCTTTAGTGTGTGTGAATCATGATGGTCAGGGTGATGGACCAACTGTTAAGGATATCCGTATGGACAACTTCAATATATCTG
TCGGTGGTCGTGAACTTATTGTCGATGGTTCTGTCACGCTTTCTTTTGGAAGACACTACGGTCTTATTGGAAGAAACGGTACAGGGAAAACAACT
CTCCTGAGGCATATGGCTATGCACGCTATTGATGGTATTCCCAGGAACTGCCAGATATTGCATGTTGAGCAAGAAGTGGTTGGTGATAATACCTC
AGTTTTGCAATGTATTCTTAACACTGATATGGAGAGAACCCAACTTCTGGAAGAAGAGGCTCGTCTGCTTGAATTACAGAGAGTGACCGACTTAG
AAGGCGAATCTGCAAAGAGTGATAAGTTGAATGGAGGTATCGACAAAAATTCGCAAGCAAAAAGGCTTGAAGAGATATACAAAAGACTTGATTTC
ATTGATGCTTACTCGGCTGAGTCACGTGCAGCAACTATACTATCGGGTTTGAGCTTCTCTCCAGAAATGCAAAAGAGAGCAACCAAAACATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294168] SGN-U566380 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106011 [Download][View] Facility Assigned ID: TMEBZ28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5