EST details — SGN-E294475

Search information 
Request: 294475Match: SGN-E294475
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81091Clone name: cLET-14-H18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184705 is on microarray TOM1: SGN-S1-1-2.4.14.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81091 [cLET-14-H18] Trace: SGN-T106317 EST: SGN-E294474 Direction: 5' Facility: TIGR
Clone: SGN-C184705 [TUS-45-H15] Trace: SGN-T198698 EST: SGN-E397372 Direction: 3' Facility: INRA
Clone: SGN-C184705 [TUS-45-H15] Trace: SGN-T198699 EST: SGN-E397373 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294475Length: 511 bp (845 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E294475 [] (trimmed) GTAAAATGGCTACCAAACATCTTTTTTTCTTTGCTATTCTCTTGTTTTCAGCTGCCTCTGTTTTTGCAGAGGAAAATCCTAGCCTTGTAATGGAC
TATTACAAGGACACTTGCCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAGAATACTGCATTTTCTTGGCT
AAGAAACATATTCCATGACTGCTTTGTTGAGTCATGTGATGCTCCTTGTTGCTGGACTCAACAAGGAGGATGCTTCTGAGAAAGAGACAGACAGG
AGTTTTGGTATGAGAAATTTCAGATACATTGAGACTATTAAAGAAGCTGTAGAAAGGGAGTGCCCTGGTGTTGTTTCTTGTGCTGATATTCTTGT
GTTGTCTGGTAGAGATGGTATTGTTGCTCTAGGAGGGCCACACATTCCTCTCAAAACTGGAAGAAGAGATGGAAGAAAAAGCAGAGCAGACATTC
TTGAACAGCACCTCCCAGATCACAATGAAAGCATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294475] SGN-U577555 Tomato 200607 Build 2 210 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106318 [Download][View] Facility Assigned ID: TMECD45TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5