EST details — SGN-E294605

Search information 
Request: 294605Match: SGN-E294605
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83003Clone name: cLET-22-N9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181960 is on microarray TOM1: SGN-S1-1-3.2.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181960 [TUS-38-F6] Trace: SGN-T1698 EST: SGN-E378305 Direction: 5' Facility: Giov. Lab
Clone: SGN-C181960 [TUS-38-F6] Trace: SGN-T187767 EST: SGN-E374497 Direction: 3' Facility: INRA
Clone: SGN-C181960 [TUS-38-F6] Trace: SGN-T187768 EST: SGN-E374498 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294605Length: 418 bp (956 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294605 [] (trimmed) CAATTTTCCAATGGAACATGTTAAAAAATCTCTTGAAAATATTGAGTATTCTTGTAAAGATGGATTATCTCCAGCTGCTGTTTTAAAAGCTACTC
ATAAAACTAGAAGAGTCAAGCACAAGAGAAGTAGTAGAAAGAAGAAGAATGAGAATTTGGAAAATGTTTTTGTTTTTCAAGACTTGGGAGTTGAA
TTATTAGAAGAGCTTTTAATGACTTCATCATAGGAATGTTTATTATATTCTTCGTGTCGAAAATACTAAGTTCAGTTTTCGTGGGAGATAATAAT
CAAGATCGCAATGTACGAGTCTCTTTTTTTTCTTTTTTTTTTTATTTGGTCTGGATTTCTTGAAGAATTTAGAGTTTAGTTTCAAGAAGAGCTTT
TGATGAGTTGAAATAATGTCTCAGACTTGTTTTGGTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294605] SGN-U574873 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107991 [Download][View] Facility Assigned ID: TMEDI77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0054 Quality Trim Threshold: 12.5