EST details — SGN-E294798

Search information 
Request: 294798Match: SGN-E294798
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81723Clone name: cLET-17-N23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C185038 is on microarray TOM1: SGN-S1-1-5.2.12.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185038 [TUS-46-F12] Trace: SGN-T192000 EST: SGN-E390674 Direction: 5' Facility: INRA
Clone: SGN-C185038 [TUS-46-F12] Trace: SGN-T192254 EST: SGN-E390928 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294798Length: 393 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294798 [] (trimmed) AACACAAACAGACATTCCATTCAAGAAACTTTCTTGAGCCTCTAAATTAATAAAAATGTAAATTAACAACATGAAAACAAACACAACAAAATGAA
AACTTCCCAAATCTACACCTTATTTTTATTATATGATTCAAAGTAAGTGTAGATCATTAATCTATGTTGCTGATGTCCAAACAATATCCTTAAGT
GCTGGTCTTAGCTCTTTGCTGCAGAATTGATTATACTCCAATGTATCACCACTTGCTTTATTCACTTCCACAACTAGAAATGAATTTGTCACAGC
AAATATATCAGCAGCAATTCCTAATTTCCCTTTTCTCCCCACCACTTGTCCTTGTAGTTTTACACAGGAATCACTCTTTTTTACGATGAAATTCG
TTGTCTTTGCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294798] SGN-U583600 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106853 [Download][View] Facility Assigned ID: TMECO84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5