EST details — SGN-E294969

Search information 
Request: 294969Match: SGN-E294969
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81546Clone name: cLET-17-B4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184524 is on microarray TOM1: SGN-S1-1-7.1.14.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184524 [TUS-45-A2] Trace: SGN-T1832 EST: SGN-E378734 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184524 [TUS-45-A2] Trace: SGN-T198601 EST: SGN-E397275 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294969Length: 412 bp (772 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294969 [] (trimmed) TGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTGTCTTTGACCTTACCATCGGTGGTGCACCAGCTGGTCGTGTGGTGATGGAGC
TCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTTGCACTAC
AAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGATCTATGG
AGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCCCTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACCAACGGGTCTCAGT
TTTTCATCTGTACCGCTAAGACTGAGTGGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294969] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107024 [Download][View] Facility Assigned ID: TMECP02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5