EST details — SGN-E295070

Search information 
Request: 295070Match: SGN-E295070
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85745Clone name: cLET-40-G1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184826 is on microarray TOM1: SGN-S1-1-1.1.14.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184826 [TUS-45-M16] Trace: SGN-T196569 EST: SGN-E395243 Direction: 5' Facility: INRA
Clone: SGN-C184826 [TUS-45-M16] Trace: SGN-T198635 EST: SGN-E397309 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295070Length: 387 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295070 [] (trimmed) TGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCA
CTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAAGCTTACCCTCAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCGTCAA
GTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAAATGCCAATTTTTAATTATGTAATGTATAACTGACCCTATGTATTTAGGG
GAAGCTTGTTTGAATCCTCCTTAAAGTTTTTCTCTGGAGAAACTGTAGTAATTTTACTTTGTTGTGTTCCCTTCATCTTTTGAATTAATGGCATT
TGTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295070] SGN-U578438 Tomato 200607 Build 2 819 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110303 [Download][View] Facility Assigned ID: TMEGA37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0160 Quality Trim Threshold: 12.5