Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E295793

Search information 
Request: 295793Match: SGN-E295793
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83522Clone name: cLET-25-B1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191043 [TUS-61-P17] Trace: SGN-T342147 EST: SGN-E541272 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191043 [TUS-61-P17] Trace: SGN-T342149 EST: SGN-E541274 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295793Length: 362 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295793 [] (trimmed) GGGTTCGGGGCTACCTAGGTTTGAAGAGGTGATTCCTGGAGTGTGTTTTGGAGCTCGGAACAGTTTGGAACAAGCATCTGCATTGGTAAACAAAG
GGGTGCTTAAATCTCATGATTTCAGATTCTTTGTTGGCTATGCGGGGTGGCAGCTTGACCAGTTGAGGGAAGAGATTGAATCTGGCTATTGGTAT
GTTGCCTCTTGTAGTGCAAATCTGATTTTTGCAGGTTCGCAAACTTCGTCATCAGAGAGTTTGTGGGTAGAAATATTACAGCTGATGGGTGGTCA
GTATTCTGAATTAAGTCGGAAGCCTAAGCAAGACATATAACTTCTCAATGGTCACTTTACTGTCAAAACCGAGCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295793] SGN-U580758 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108518 [Download][View] Facility Assigned ID: TMEDU01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5