EST details — SGN-E296861

Search information 
Request: 296861Match: SGN-E296861
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83900Clone name: cLET-26-J16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191082 [TUS-62-B8] Trace: SGN-T342216 EST: SGN-E541341 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191082 [TUS-62-B8] Trace: SGN-T349408 EST: SGN-E548533 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296861Length: 376 bp (947 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296861 [] (trimmed) CTTATGTGGAAAATTTGCCGGAAAATGCAGAAGCCACTACCGATGTAACTTATGAGCAAGTCAAATACCTCAAACTTGCTCAAGATGGACTCGAA
GAATCCATGGCTAAGTTTCTCGAAGATTCAGATCTTGATTTTATACTATTCGATTTTACTTCTTACTGGGTTCCTTCAATTGCTTCAAAATTCAA
CATTCGGTCAGGTCATTTCAGCATATACATCGCTGCGTTTCTGGGTTTCACCGGACCTGTACCGGGATTAAACAATGATTATGAAATTCGTACAA
CGCCGGAGGAATATACCGTTCCCCCAAAATGGGTTCCGTTTGAAACTACAGTTGCTTTCAAGCTTTTCGAAGTCTTGAGAATCTTCGAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296861] SGN-U573907 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108913 [Download][View] Facility Assigned ID: TMEDZ56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5