EST details — SGN-E297257

Search information 
Request: 297257Match: SGN-E297257
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84499Clone name: cLET-29-A22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184782 is on microarray TOM1: SGN-S1-1-5.3.14.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184782 [TUS-45-K20] Trace: SGN-T198631 EST: SGN-E397305 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297257Length: 345 bp (1036 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E297257 [] (trimmed) TTCAGAGAGGCCGCTGATAAGGAACTCAATGGCATTCTATCTGTCTGTGATGAACCACTCGTGTCAGTTGACTTCCGGTGCAGTGACGTGTCATC
AACTGTTGATTCTTCACTCACCATGGTCATGGGAGATGACATGGTTAAGGTTATTGCTTGGTATGACAATGAATGGGGTTACTCACAGAGGGTTG
TTGATCTTGCTGACATTGTTGCAAACCAGTGGAAATGAAACATGAAAATAAAATAAAGCAGTACTACTAAATAGTGGCTTAATTTATATTTTTTT
AACCTTGCTTGTAGATTCTTATTCCTTTTTGAAAATTGTAATGAGAACTATAACAATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297257] SGN-U578802 Tomato 200607 Build 2 332 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109672 [Download][View] Facility Assigned ID: TMEEJ11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0260 Quality Trim Threshold: 12.5