EST details — SGN-E298725

Search information 
Request: 298725Match: SGN-E298725
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86796Clone name: cLET-44-F12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179864 is on microarray TOM1: SGN-S1-1-3.2.1.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179864 [TUS-32-N22] Trace: SGN-T1563 EST: SGN-E378561 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179864 [TUS-32-N22] Trace: SGN-T186269 EST: SGN-E372788 Direction: 3' Facility: INRA
Clone: SGN-C179864 [TUS-32-N22] Trace: SGN-T186270 EST: SGN-E372789 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298725Length: 437 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298725 [] (trimmed) TCAGCGGACTTTTTGGGTCGTAGGCAACAACTCTGAGAAGGACCGTATAAAAGAACGCGACATCAGAACCGATCCCGGGACCCGTTTATCCCCAG
AAATCAAAAGAGCCAAAGGATCACGTATCAATCGCCGCGTAGGCAAAAAGGGACGCAAACACCCTAGTGTCGACGGAATCCACACCCGCGATGGA
GAACTCGAACGGGCAAGCGAGGGAGAAAACGACCCATAGAAAAGTAACGCCGTCACCCTCCAACTCGTAAGCACCTCACGCACGAAACAAAAGTA
TACCAACCGTCATCGTCACGCAACACGCAAGCACGCAACAGGGCCGCGGATTCCCATTATGGTCCGCGCCATCCCAAGCACGCTCGCCAAACAAA
CGGAATATCAGCCCGCCTCATATAGACCGAGCCATCCCAAGCACGCTCGCCAAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298725] SGN-U597378 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111361 [Download][View] Facility Assigned ID: TMEGT30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5