EST details — SGN-E298859

Search information 
Request: 298859Match: SGN-E298859
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86764Clone name: cLET-44-D20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179853 is on microarray TOM1: SGN-S1-1-6.2.1.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179853 [TUS-32-N11] Trace: SGN-T186177 EST: SGN-E373024 Direction: 3' Facility: INRA
Clone: SGN-C179853 [TUS-32-N11] Trace: SGN-T186178 EST: SGN-E373025 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298859Length: 416 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298859 [] (trimmed) GCGGACTTTTTGGGTCGTAGGGCAAGCCCGAGAAATGCTCAGCTCAGAGAGAAACGGTAAACTTAAAGGCCCCTCCCGATTCCATTACTGGCGGC
GTATTAGTCGGCTGCGCGGCGACGGAGTCTCCTGTTGACATTATCTTTAAAATTGTCGAGAATCCTTGAGTCTCCCGCATTGGCGAGAAAGGCGC
CGGAAAGACGGGGAAGTTCCCGTATCATAAGGGTCTAATTCCTTATTGCGCGACTTTAGGGCCTACGCGCTAAGGAGGCGACCCTATTGGTGGAA
ATGGGATTGGAGGAGAGCTGACTCACGGAGTTAAACCTAATGACGAGAATCCTGCCAAGAAGTATATTGGTTTCGGAACTTCTCTTACGGTCAAC
GTCGGATTCGGAATTAATGGCCTCTAACCCCCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298859] SGN-U566322 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111495 [Download][View] Facility Assigned ID: TMEGT22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0066 Quality Trim Threshold: 20.5