EST details — SGN-E298860

Search information 
Request: 298860Match: SGN-E298860
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86766Clone name: cLET-44-D22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179854 is on microarray TOM1: SGN-S1-1-5.2.1.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179854 [TUS-32-N12] Trace: SGN-T186265 EST: SGN-E372784 Direction: 3' Facility: INRA
Clone: SGN-C179854 [TUS-32-N12] Trace: SGN-T186266 EST: SGN-E372785 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298860Length: 355 bp (962 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298860 [] (trimmed) GACTTTTTGGGTCGTAGGAGAGGTGCGGTACGGTCGCCGTAAAAACCCTTTTAACCGGTAGACTGGCCGCGACCGAAGAAGCACGACCGGCTCCA
CAAGACCGAAGCCAACCCACGAGGGGAAAAAAAACTAGCACACATACGCTACCATCCGCAACGCAAGTTCGAAAGGTCCCATCAGCACGCATACA
ACGAACCCGCGTACAGCCATCCGACAAAAACACCTACCCTTATTCCGCACGCTACGGCGAACAAACCAAACCCCATCACCTAGACCCATAGCAAC
ACCCCATGGAGAAGCGTATAAACATTACGACGCCGTTACCCTATAAAACAAAAAAAACAACCCATGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298860] SGN-U603560 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111496 [Download][View] Facility Assigned ID: TMEGT23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5