EST details — SGN-E298899

Search information 
Request: 298899Match: SGN-E298899
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86994Clone name: cLET-44-P22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179946 [TUS-33-B8] Trace: SGN-T186949 EST: SGN-E374335 Direction: 3' Facility: INRA
Clone: SGN-C179946 [TUS-33-B8] Trace: SGN-T186950 EST: SGN-E374336 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298899Length: 334 bp (956 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298899 [] (trimmed) GTGGACTTTTTGGGTCGTAGGCAAAAAACCGTCGTCACCATACCTCTCCATTTAAACCCCGAATATTCCCATTAAACCAACGGTGGAAGAAGAGA
AACTAGCGTAAGAAGAGTCCCTATCCTTGACCTCATCAGTCGATAGAGCAACTAAACACGTCTAAGAAGTTGAACTTCCAAAAGCAGAACGTGTT
GAGTCTGTATGTTATGTCATCTAGTCTATTTAGCCCTCTTGACTAATGGCCTGGTCTATTAGCCTCCTATAACTTTAGCTATCGCATGATTGGTT
CACTTGTTGGACAATCCTCGAAGCTATTAAAATCTCCGAATGGGTATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298899] SGN-U602465 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111535 [Download][View] Facility Assigned ID: TMEGT95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0108 Quality Trim Threshold: 20.5