EST details — SGN-E305920

Search information 
Request: 305920Match: SGN-E305920
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96747Clone name: cLEY-17-H20
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193003 [TUS-67-B9] Trace: SGN-T345519 EST: SGN-E544644 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193003 [TUS-67-B9] Trace: SGN-T345520 EST: SGN-E544645 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305920Length: 445 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305920 [] (trimmed) GGAAACCTTCTGATATAACACCACTCTCCCTGAGCGGCGCCGGATACTTAGGTTTATCTTCACCGTCACGGCGTTGCTAGCAGAACCCTACTCCA
CCGTTGAAGCGGTCCGATCATATTTCCGACGAAGCTGATATGTCAATGAAGTTGACTCCTTCCAAGAGATCACATGATCAGGGCCCTGTAGAAAC
AAATGGCCGAGGGAAGTGGCAGAAATCATCATCTTTTAGTTCCCAGAGATCACCTGCGAAAGTTCGTATATTATGCCCTGCTTCAAAAATAATTT
TCCTTATCGGAGAGGATAGTAGCATTATTTCTCGGATACAAGAGGAAACAGGTGCAGAGGTTCGAGTTGAGGATAGTATTGTCGGTTGTGATGAG
AAGGTGATAGTTATTGTAGGTGCAGGAAAAGAAGATGAAGTGGTAACCAAACAGTTCCAAGCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305920] SGN-U567877 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120204 [Download][View] Facility Assigned ID: TRYCP46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5